|
BioRay Inc
single-guide rna (sgrna) designed to target ripk3 kinase domain Single Guide Rna (Sgrna) Designed To Target Ripk3 Kinase Domain, supplied by BioRay Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-guide rna (sgrna) designed to target ripk3 kinase domain/product/BioRay Inc Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) designed to target ripk3 kinase domain - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
single-guide rnas Single Guide Rnas, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-guide rnas/product/Synthego Inc Average 90 stars, based on 1 article reviews
single-guide rnas - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Biomatters Ltd
single guide rna (sgrna) Single Guide Rna (Sgrna), supplied by Biomatters Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rna (sgrna)/product/Biomatters Ltd Average 90 stars, based on 1 article reviews
single guide rna (sgrna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
single guide rna (grna) sequence (attgtcagcaccaaacagcg) Single Guide Rna (Grna) Sequence (Attgtcagcaccaaacagcg), supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rna (grna) sequence (attgtcagcaccaaacagcg)/product/GenScript corporation Average 90 stars, based on 1 article reviews
single guide rna (grna) sequence (attgtcagcaccaaacagcg) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
optimized multi single-guide rna (sgrna) payload sequences attached in supplementary table1 ![]() Optimized Multi Single Guide Rna (Sgrna) Payload Sequences Attached In Supplementary Table1, supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/optimized multi single-guide rna (sgrna) payload sequences attached in supplementary table1/product/Synthego Inc Average 90 stars, based on 1 article reviews
optimized multi single-guide rna (sgrna) payload sequences attached in supplementary table1 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
nucleotide fragments of cd26 2/3g and control cd8 2/3g ![]() Nucleotide Fragments Of Cd26 2/3g And Control Cd8 2/3g, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/nucleotide fragments of cd26 2/3g and control cd8 2/3g/product/GenScript corporation Average 90 stars, based on 1 article reviews
nucleotide fragments of cd26 2/3g and control cd8 2/3g - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Synthego Inc
prdm1-targeting single-guide rna (sgrna) ![]() Prdm1 Targeting Single Guide Rna (Sgrna), supplied by Synthego Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/prdm1-targeting single-guide rna (sgrna)/product/Synthego Inc Average 90 stars, based on 1 article reviews
prdm1-targeting single-guide rna (sgrna) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
GenScript corporation
genome-wide brunello single guide rna (sgrna) library ![]() Genome Wide Brunello Single Guide Rna (Sgrna) Library, supplied by GenScript corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/genome-wide brunello single guide rna (sgrna) library/product/GenScript corporation Average 90 stars, based on 1 article reviews
genome-wide brunello single guide rna (sgrna) library - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Oligos Etc
for sgrna cloning ![]() For Sgrna Cloning, supplied by Oligos Etc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/for sgrna cloning/product/Oligos Etc Average 90 stars, based on 1 article reviews
for sgrna cloning - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Genechem
single guide rnas (sgrnas) ![]() Single Guide Rnas (Sgrnas), supplied by Genechem, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single guide rnas (sgrnas)/product/Genechem Average 90 stars, based on 1 article reviews
single guide rnas (sgrnas) - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Broad Institute Inc
crispr interference 4 small guide rna (sgrna) candidates for atg14 ![]() Crispr Interference 4 Small Guide Rna (Sgrna) Candidates For Atg14, supplied by Broad Institute Inc, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/crispr interference 4 small guide rna (sgrna) candidates for atg14/product/Broad Institute Inc Average 90 stars, based on 1 article reviews
crispr interference 4 small guide rna (sgrna) candidates for atg14 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
Obio Technology Corp Ltd
single-guide rna (sgrna) of spink4 and egfr ![]() Single Guide Rna (Sgrna) Of Spink4 And Egfr, supplied by Obio Technology Corp Ltd, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/single-guide rna (sgrna) of spink4 and egfr/product/Obio Technology Corp Ltd Average 90 stars, based on 1 article reviews
single-guide rna (sgrna) of spink4 and egfr - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
Image Search Results
Journal: bioRxiv
Article Title: β2-Adrenergic Biased Agonist Nebivolol Inhibits the Development of Th17 and the Response of Memory Th17 Cells in an NF-κB-Dependent Manner
doi: 10.1101/2024.09.08.611829
Figure Lengend Snippet: Effect of A) β1AR antagonist (metoprolol) and B) non-selective βARs antagonist (bupranolol) on the production of IL-17A on memory Th cells. Activated memory Th cells were blocked for 30 minutes with metoprolol or bupranolol before treatment with nebivolol and incubated for five days. IL-17A was measured in cell culture supernatants. Pooled data are expressed as the Mean ± SEM of four independent biological experiments. Effect of CRISPR/Cas9-mediated knockout of β2AR on nebivolol treatment in activated memory Th cells. Stimulated memory Th cells were electroporated with a CRISPR/Cas9 system targeted by multi-sgRNA against β2AR or non-targeting genes. C) The expression of ADRB2 at mRNA levels as verification in non-electroporated, non-targeting and β2 multi-sgRNA conditions has shown as the relative amounts normalized to housekeeping RNA and compared to a control set to 1.0 (dotted line). The data of this figure is representative of three independent biological experiments. Three days after electroporation, memory Th cells were cultured with or without nebivolol for another 5 days and D) A representative of IL-17A levels in cell culture supernatants in both control and knock-out β2AR conditions was shown. ANOVA was followed by Tukey’s multiple comparisons tests.
Article Snippet: According to published protocols ( , ), before electroporation briefly, 100 pmol of optimized multi
Techniques: Incubation, Cell Culture, CRISPR, Knock-Out, Expressing, Control, Electroporation
Journal: Nature Communications
Article Title: Therapeutic potential of the secreted Kazal-type serine protease inhibitor SPINK4 in colitis
doi: 10.1038/s41467-024-50048-y
Figure Lengend Snippet: a Relative expression of IEC markers from different branches, including enteroendocrine cells ( Neurog3 , Insm , and Pax4 ), secretory lineage ( Muc2 , Gfi1 , Foxa2 , Reg3a , and Lyz ), M cells ( Spib ), Tuft cells ( Dclk ), stem cells ( Olfm4 , Lgr5 ), and absorptive cells ( Si ) in mouse organoids with rSPINK4 stimulation. The degree of color depth indicates the abundance of expression positively. b Levels of phosphorylated and total EGFR in NCM460 and HT-29 cells with 5 ng/mL rSPINK4 stimulation for 0–60 min. c Direct downstream molecules of the EGFR pathway detected using western blotting with rSPINK4 stimulation for 0–60 min. d Typical fluorescent images of intestinal organoids from WT and KO mice including MUC2 (green), E-cadherin (red), and DAPI (blue), with rSPINK4 (100 ng/mL) and AG1478 (10 μM) stimulation under inflammatory conditions (50 ng/mL TNF-α treatment). e Quantitative analysis of weight loss with SPINK4 and gefitinib intervention following DSS administration in the control group drinking water (control, n = 4); DSS and PBS administration group (DSS + PBS, n = 6); DSS and rSPINK4 administration group (DSS + rSPINK4, n = 5); and DSS, rSPINK4, and gefitinib administration group (DSS + rSPINK4 + gefitinib, n = 4). f Representative canonical endoscopic images with the lesion circled with white arrows. g Quantification of colonic length. h The levels of the phosphorylated and total EGFR were determined in WT and KO mouse tissues (upper panel) and rSPINK4 treatment group (lower panel). Data are presented as the mean ± SEM. All tests were two-sided. Statistical significance was calculated using unpaired Student’s t test ( h ). Besides, Kruskal–Wallis test ( h ) and one-way ANOVA ( b , e , g ) were performed for multiple comparison; n = 3–5 biologically independent experiments ( b , g , h ). Source data are provided as a Source Data file.
Article Snippet: Transient transfection was achieved via single-guide RNA (sgRNA) of SPINK4 and
Techniques: Expressing, Western Blot, Control, Comparison
Journal: Nature Communications
Article Title: Therapeutic potential of the secreted Kazal-type serine protease inhibitor SPINK4 in colitis
doi: 10.1038/s41467-024-50048-y
Figure Lengend Snippet: a The FLAG-SPINK4 protein, which exists in the concentrated medium of SPINK4- overexpressing cells, is involved in the EGFR protein from cell lysis combined with EGFR antibody. IgG is the contrast to EGFR antibody. b The binding test of rSPINK4 protein and EGFR in membrane extraction under the incubation in vitro. c rSPINK4 coprecipitates with rEGFR (extracellular part) mutually in the in vitro pull-down assay controlled by IgG. d Representative immunofluorescent image of rSPINK4 and EGFR localization (EGFR: green, rSPINK4: red, DAPI: blue). e The curve of released heat and change in △H are performed when the rEGFR-His protein (6 μM) is titrated by rSPINK4-His protein (30 μM) via the ITC assay. f The pull-down assay of rEGF and rEGFR (extracellular part) in a SPINK4-dose-dependent manner. The concentration of rSPINK4 is shown. g A typical binding curve between biotinylated EGF and EGFR was performed using AlphaLISA binding assay. h Image profile of the interaction between rSPINK4 and the deleted extracellular domain of EGFR (△1: the deletion of 57–168 aa, △2: the deletion of 177–338 aa, △3: the deletion of 361–481 aa, △4: the deletion of 505–637 aa, ED: whole extracellular EGFR, NC: vector). i Interaction between mutant rSPINK4 (wt: whole sequence of SPINK4, mut1: mutation sites: C65A, C68A, and C86A, mut2: mutation sites: Q48A and M49A, NC: vector) and extracellular EGFR in vitro. j Predictive interactive model of SPINK4 and extracellular EGFR (pink: SPINK4, the tail is at N-terminal; red: EGFR subdomain including 57–168 aa; green: EGFR subdomain including 177–338 aa; yellow: EGFR subdomain including 361–481 aa; orange: EGFR subdomain including 505–637 aa). Data are presented as the mean ± SEM. The Statistical test was two-sided using one-way ANOVA ( g ); n = 6 biologically independent experiments ( g ). Source data are provided as a Source Data file.
Article Snippet: Transient transfection was achieved via single-guide RNA (sgRNA) of SPINK4 and
Techniques: Lysis, Binding Assay, Membrane, Extraction, Incubation, In Vitro, Pull Down Assay, Isothermal Titration Calorimetry, Concentration Assay, Plasmid Preparation, Mutagenesis, Sequencing
Journal: Nature Communications
Article Title: Therapeutic potential of the secreted Kazal-type serine protease inhibitor SPINK4 in colitis
doi: 10.1038/s41467-024-50048-y
Figure Lengend Snippet: a , b SPINK4 levels in LS174T cell supernatant stimulated with Pam2CSK4 ( a ) and carbachol ( b ). c , d Relative expression of SPINK4 with 100 μg/mL Pam2CSK4 stimulation in human intestinal organoids ( c ) and with stimulation with a lower concentration (0.01 μg/mL) in mouse intestinal organoids ( d ). e SPINK4 expression presented with MUC2, Lyz, and CgA values in the intestinal organoids from WT and cKO mice with Pam2CSK4 treatment. f Gel-forming mucin and transmembrane mucin expression when SPINK4 was overexpressed or knocked out were assessed using qRT-PCR test. OE, overexpression; NC, negative control; KO, knockout. g MUC2 expression was influenced by the intrinsic SPINK4 levels in the LS174T cells and the phosphorylated EGFR levels. OE, overexpression; NC, negative control; KO, knockout. Blank indicates no vector involved. h , i The correlation between MUC2 level with SPINK4 expression in IBD. The mRNA level was normalized to β-actin level ( h ). The Pearson correlation coefficient ( r ) was used to estimate the correlation between MUC2 and SPINK4 expression ( i ). j The apparent difference in colonic permeability following Spink4 knockout (UEA1: green, EUB338: red, DAPI: blue; white arrows: the bacteria which penetrate the inner mucus layer; red triangles: the outside of the inner mucus layer. Data are presented as the mean ± SEM. All tests were two-sided. Statistical significance was calculated using unpaired Student’s t test ( d , g ) and one-way analysis of variance (ANOVA) ( a , b , g ). Mann–Whitney U test and Kruskal–Wallis test were performed on non-normal data ( c , h ); n = 3 biologically independent experiments ( a – d , g ). Source data are provided as a Source Data file.
Article Snippet: Transient transfection was achieved via single-guide RNA (sgRNA) of SPINK4 and
Techniques: Expressing, Concentration Assay, Quantitative RT-PCR, Over Expression, Negative Control, Knock-Out, Plasmid Preparation, Permeability, Bacteria, MANN-WHITNEY
Journal: Nature Communications
Article Title: Therapeutic potential of the secreted Kazal-type serine protease inhibitor SPINK4 in colitis
doi: 10.1038/s41467-024-50048-y
Figure Lengend Snippet: a Circulating SPINK4 level from healthy controls ( n = 64), UC ( n = 51), and CD patients ( n = 108) detected using ELISA. b SPINK4 levels between remission and active stages, based on clinical characteristics (left) or endoscopic performance (right) in the sera of IBD patients. c , d The efficiency of SPINK4 (red line), ESR (green line), CRP (blue line), and PLT (orange line) values for endoscopic ( c ) or clinical ( d ) activity assessment are shown via ROC curve. e Percentage of different level of SPINK4 in multiple intestinal locations including L1 (ileal), L2 (colonic), and L3 (ileocolonic), according to the Montreal classification. f Graphic abstract showing the involvement of extracellular SPINK4 in the regeneration of GCs via directly targeting EGFR pathway. Data are presented as the mean ± SEM. All tests were two-sided. Statistical significance was calculated using unpaired Student’s t test ( b , c ) and one-way analysis of variance (ANOVA) ( a ). Source data are provided as a Source Data file.
Article Snippet: Transient transfection was achieved via single-guide RNA (sgRNA) of SPINK4 and
Techniques: Enzyme-linked Immunosorbent Assay, Activity Assay